kivonatolt verzió


Eredeti cikk dátuma:
Eredeti cikk címe:
Eredeti cikk szerzői: Dawei Wang, MD; Bo Hu, MD; Chang Hu, MD; Fangfang Zhu, MD; Xing Liu, MD; Jing Zhang, MD; Binbin Wang, MD; Hui Xiang, MD; Zhenshun Cheng, MD; Yong Xiong, MD; Yan Zhao, MD; Yirong Li, MD; Xinghuan Wang, MD; Zhiyong Peng, MD
Eredeti cikk elérhetősége: https://doi.org/10.1093/annhyg/mep070
Fordító(k): Vozár Ágnes
Lektor(ok): dr. Lőrincz Orsolya
Nyelvi lektor(ok):
Szerkesztő(k): Varga Katica

Figyelem! Az oldalon megjelenő cikkek esetenként politikai jellegű megnyilvánulásokat is tartalmazhatnak. Ezek nem tekinthetők a fordítócsoport politikai állásfoglalásának, kizárólag az eredeti cikk írójának véleményét tükrözik. Fordítócsoportunk szigorúan politikamentes, a cikkekben esetlegesen fellelhető politikai tartalommal kapcsolatosan semmiféle felelősséget nem vállal, diskurzust, vitát, bizonyítást vagy cáfolatot nem tesz közzé.

Az oldalon található információk nem helyettesítik a szakemberrel történő személyes konzultációt és kivizsgálást, ezért kérjük, minden esetben forduljon szakorvoshoz!


Jelentőség: 2019. decemberében Wuhanban (Kína) egy új típusú koronavírus okozta pneumonia járvány ütötte fel a fejét. A fertőzések száma gyorsan emelkedett, ám a fertőzött betegek klinikai sajátosságairól szóló információk meglehetősen korlátozottak.

Cél: Az új típusú koronavírus fertőzésből származó tüdőgyulladásban (Novel Coronavirus–Infected Pneumonia, NCIP) szenvedő betegek epidemiológiai és klinikai sajátosságainak leírása.

Módszerek, résztvevők: Retrospektív vizsgálat,138 beteg bevonásával, akik 2020. január 1. – 2020. január. 28. közt igazolt NCIP-vel feküdtek a Wuhani Egyetem Zhongnan Kórházában. Az utánkövetés 2020. február 3-ig tartott.

Vizsgálat köre: dokumentált NCIP esetek.

Eredmények, mérések: Epidemiológiai, demográfiai, klinikai, laboratóriumi, radiológiai és kezelési eredmények adatait gyűjtötték és elemezték. A kritikus, és nem-kritikus betegek eredményeit vetették össze. Azon esetekben, ahol az egészségügyi ellátószemélyzet és az azonos kórteremben fekvő betegek is megfertőződtek, vizsgálták a kórházon belüli transzmisszió lehetőségét is.

Eredmények: A 138 NCIP miatt hospitalizált beteg átlagéletkora 56 év volt (Interquartilis tartomány IQR: 42-68, tartomány: 22.92 év), közülük75 (54.3%) férfi. Az érintett kórházi dolgozók (40 [29%]) és hospitalizált betegek (17[12,3%]) között valószínűsíthető volt a kórházi transzmisszió lehetősége.

A leggyakoribb tünetek a következők voltak: láz (136 [98,6%]), fáradékonyság (96[69,9%]), száraz köhögés (82 [59,4%]). Lymphopeniat (lymphocyta szám: 0,8×109 /L[IQR: 0,6-1,1]) 97 (70,3%), megnyúlt prothrombin időt (13 sec [IQR: 12,3-13,7]) 80 (58%) esetben, emelkedett lactate-dehydrogenase értéket (261 U/L[IQR: 182-403]) 55 (39,9%) betegnél észleltek. Mellkas CT felvételek kétoldali foltos beszűrődést, vagy tejüveg-homályt (GGO) mutattak minden beteg tüdejében. A legtöbb beteg antivirális terápiában (oseltamivir 124[89,9%]) néhányuk antibiotikus kezelésben részesült (moxifloxacin, 89[64,4%], ceftriaxon, 34 [24,6%], azithromycin, 25 [18,1%]) és glükokortikoid terápiát 62 páciens kapott [44,9%].

Harminchat (26,1%) beteg került intenzív osztályra komplikációk miatt, úgymint akut respiratorikus distressz szindróma (ARDS, 22 [61,1%]) arrhythmia (16 [44,4%]), és shock (11 [30,6%]).

Az első tünetek megjelenésétől a dyspnoe-ig eltelt idő medián értéke 5 nap, a kórházi felvételig eltelt idő 7 nap, és az ARDS-ig jelentkező idő 8 nap volt.

Az intenzív osztályon kezelt betegek (n=36) életkora az intenzív osztályos kezelést nem igénylő betegekéhez (102) képest magasabb volt (átlag 66 vs 51), nagyobb gyakorisággal szenvedtek egyéb társbetegségekben (26 [72,2%] vs 38 [37,3%]), és fordult elő náluk dyspnoe (23 [63,9%] vs 20 [19,6%]) valamint étvágytalanság (24 [66,7%] vs 31 [30,4%]). A 36 intenzív osztályon kezelt beteg közül 4-en (11,1%) kaptak nagy áramlású oxigén kezelést, 15 (41,7%) páciens non-invazív lélegeztetésben, 17 (47,2%) fő pedig invazív lélegeztetésben részesült. Az utóbbi csoportban 4 esetben volt szükség extracorporalis membran oxygenizációra (ECMO).

Február 3-ára 47 beteg (34,1%) gyógyult meg, 6-an meghaltak (teljes mortalitás 4,3%), a többi beteg továbbra is hospitalizált volt. A gyógyultak között a kórházi tartózkodás átlagideje 10 nap volt (IQR: 7-14).

Következtetések, jelentőség: Ebben az egyközpontú esettanulmányban 138 igazolt NCIP-s beteget vizsgáltak, ahol a betegek 41%-nál volt feltételezhető, hogy a kórházban fertőződtek meg, a betegek 26%-a szorult intenzív terápiás kezelésre, a mortalitás 4,3% volt.

2019. decemberében Kínában, a Hubei tartomány-beli Wuhanban csoportosan jelentkező akut légúti megbetegedés ütötte fel a fejét – amely ma már az új típusú coronavírus (COVID19) okozta pneumoniaként (NCIP – novel coronavirus–infected pneumonia) ismert (1-5). A betegség gyorsan terjedt Wuhanból a többi régióba. 2020. január 31-ére Kínában 9692 igazolt eset volt. Világszerte 24 országból, 5 kontinensről jelentettek eseteket6. 2020. Január 3-án egy wuhani beteg alveolaris lavage mintájából izolálták az új típusú coronavírust (2019-nCoV), felfedezve annak kóroki szerepét a NCIP-ban (7). Teljes genom szekvenálás és filogenetikai analízis segítségével derítették ki, hogy a 2019-nCoV a betacoronavírusok egy különálló kládjába tartozik, mely különbözik mind a súlyos akut légzőszervi szindrómát (SARS) és a Közép-Keleti légzőszervi szindrómát (Middle-Eastern Respiratory Syndrome, MERS), okozó vírusoktól (7).

A 2019-nCoV a coronavírusok családjának tipikus jellemzőit hordozza és a betacoronavíirusok 2b ágához tartozik. A 2019-nCoV a denevéreket megbetegítő coronavírusokkal mutat szoros hasonlóságot, így feltételezik, hogy a fertőzés elsődleges forrásai a denevérek.

A 2019-nCoV eredetét még mindig kutatják, a jelenlegi ismereteink alapján valószínűleg a Huanan Nagybani Halpiacon (Huanan Seafood Wholesale Market) illegálisan árult vadállatokról terjedt át először emberre (8).

A Huang és mtsai (9) által elsőként jelentett 41 NCIP megbetegedés esetében a fertőzöttek nagy részének közvetlen kapcsolata volt a Huanan Nagybani Halpiaccal.

A betegek tünetei a láz, non-produktív köhögés, dyspnoe, myalgia, fáradékonyság, normál, vagy csökkent leukocyta-szám, és radiológiailag igazolt pneumonia voltak. Súlyos esetekben szervi dysfunctio (shock, akut respiratorikus distressz szindróma [ARDS], akut szívelégtelenség, és akut veseelégtelenség) és halál is előfordult.

Később Chen és mtsai (8) újabb 99 esetet jelentettek ugyanabból a kórházból, amely felvetette annak a lehetőségét, hogy a fertőzés szoros kontaktus útján terjedhet emberről-emberre, az idős férfiakat és a társbetegséggel rendelkezőket jobban érinti, és ARDS-t okozhat. Mindazonáltal a klinikai tünetek jellemzésekor nem tettek különbséget a súlyos és nem-súlyos esetek között.

Az esettanulmányok megerősítették a NCIP emberről emberre való terjedését (10-11). Jelenleg nem áll rendelkezésre hatásos gyógyszeres terápia, vagy vakcina az NCIP ellen.

Jelen tanulmány célja a 138 NCIP-val diagnosztizált beteg klinikai jellemzőinek ismertetése, és a súlyos, intenzív osztályos kezelést igénylő és a nem-súlyos, ITO-s ellátást nem igénylő esetek összehasonlítása.

Módszerek:

Tervezés, alanyok

Ezt az esettanulmányt a Wuhani Egyetem Zhongnan Kórházának etikai bizottsága engedélyezte (engedélyszám 2020020). Minden 2020. január 1. és 2020. január 28. között a Wuhani Egyetem Zhongnan Kórházába felvett, igazoltan NCIP-vel kezelt beteget regisztráltak. Minden beteg szóbeli beleegyezését adta. A Hubei tartományi Wuhanban található Zhongnan Kórház az NCIP endémiás területen található oktatókórház, melyet a kormány jelölt ki a NCIP esetek kezelésére.

Minden NCIP-vel regisztrált beteg diagnosztizálása a WHO ideiglenes ajánlásai alapján történt (12). A klinikai eredményeket (gyógyulás, mortalitás, kórházi tartózkodás), az utánkövetés végső dátumáig 2020. február 3-ig monitorozták.

Adatgyűjtés

A betegek egészségügyi dokumentációját a Wuhani Egyetem Zhongnan Kórházának Critical Care Medicine Intézetének kutatói vizsgálták. Az epidemiológiai, klinikai, laboratóriumi és radiológiai adatokhoz és kezelési eredményekhez az elektronikus egészségügyi nyilvántartásból való adatgyűjtéssel jutottak. Az adatbázist képzett orvosok tekintették át. A rögzített információk a kórházi tartózkodás alatt felvett demográfiai adatok, orvosi kórelőzmény, expozíció, fennálló társbetegségek, tünetek, jellegzetességek, laboreredmények, CT felvételek, és kezelés (antivirális terápia, corticosteroid terápia, légzéstámogatás, művese kezelés) voltak.

A betegség kezdetének a tünetek megjelenésének napját tekintették. A tüneteket, laboratóriumi eredményeket, mellkas CT felvételeket és az alkalmazott kezeléseket a teljes kórházi tartózkodás alatt dokumentálták.

Az ARDS-t a Berlini definíció szerint (13), veseelégtelenséget a Kidnex Disease: Improving Global Outcome (14) alapján definiálták. Szívelégtelenséget akkor állapítottak meg, ha a szívizom biomarkerek (Troponin I) szérum szintje meghaladta az egészségesekre jellemző 99 percentilis határértéket, vagy ha az EKG-n vagy szívultrahangon új, kóros eltérések jelentek meg (9). Az intenzív osztályra való felvételkor meghatározták a Glasgow kóma skála, SOFA (Sequential Organ Failure Assessment) és az APACHE II (Acute Physiology and Chronic Health Evaluation II) értékeket.

Kórházon belüli terjedés gyanúja akkor merült fel, ha egy helyen dolgozó egészségügyi személyzet, vagy ugyanabban a kórteremben fekvő betegek betegedtek meg bizonyos idő alatt, és a lehetséges fertőzőforrást azonosítani tudták.

A valós idejű polimeráz-láncreakció próba (RT-PCR) a coronavírus diagnózisában

Azoktól betegektől vettek torokváladék mintát, akiknek feltehetőleg 2019-nCoV fertőzése volt. A gyűjtés után a mintákat gyűjtőcsőbe rakták 150 µL vírus tartósító oldattal együtt, és ezekből 2 órán belül teljes RNS-t vontak ki, légúti minta RNS izoláló kittel (Zhongzi, Wuhan, China). Röveiden, 40 µL sejt lizátumot pipettáztak gyűjtőcsőbe, majd 10 másodpercig vortexelték. Miután 10 percig szobahőmérsékleten állt a minta, 5 percig 1000rpm sebességgel lecentrifugálták. A kapott felülúszót használták fel a 2019-nCoV valós idejű reverz transzkripciós polimeráz-láncreakció(PCR) próbával történő kimutatásához. Két cél gént, az open reading frame lab (ORFlab)-ot és a nucleokapszid protein (N) gént amplifikálták és tesztelték egyidejűleg RT-PCR kimutatással.

1-es target gén

forward primere: CCCTGTGGGTTTTACACTTAA
reverz primere: ACGATTGTGCATCAGTGA
és a próba szekvencia: 5’-VIC-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1-3’

2-es target gén

forward primere: GGGGAACTTCTCCTGCTAGAAT
reverz primere: CAGACATTTTGCTCTCAAGCTG
 próba szekvencia: 5’-FAM-TTGCTGCTGCTTGACAGATT-TAMRA-3’.

A RT-PCR során a Shanghai bio-germ Medical Technology Co Ltd. 2019-nCoV nukleinsav detekciós kitjét használták a gyártó által előírt módon. Az esszé mix 12 µL reagens puffert, 4 µL enzim oldatot, 4 µL próba/primer oldatot, 3 µL dietil-pyrocarbonát (DEPC)-kezelt vizet, és 2 µL RNS templátot tartalmazott.

A RT-PCR eljárást az alábbi körülmények között végezték: inkubálás 15 percig 50 C°-on, majd 5 percig 95 C°-on. 40 ciklus denaturálás 15 másodpercig 94 C°-on, majd 45 másodpercig 55°C-on fluoreszcencia detektálás. A teszt 37 ciklus küszöbérték (Ct-érték) alatt volt pozitív, 40, vagy afölötti érték esetében negatív. Ezeket a diagnosztikai kritériumokat a kínai National Institute for Viral Disease Control and Prevention ajánlásai alapján állították fel. A köztes eredményeket adó mintákat (37-40 Ct-érték) újra tesztelték.

Statisztikai analízis

A kategorikus változókat gyakorisági rátákban és százalékokban, a folytonos változókat átlag, medián, és interquartilis értékekkel jellemezték. A folytonos változók esetében a csoportátlagokat független mintás t-próbával hasonlították össze, abban az esetben, ha az adatok normál eloszlást mutattak. Egyéb esetekben a Mann-Whitney tesztet használták. Nem-normál adatmegoszlás esetén az ismételt mérésekből származó eredményeket általánosított lineáris vegyes modell segítségével hasonlították össze. A kategorikus változók arányait χ2 teszttel vizsgálták. Azokban az esetekben, ahol csak kevés adat állt rendelkezésre, Fischer tesztet használtak. Minden statisztikai elemzést SSPS (Statistic Package for the Social Sciences) 13.0-s verziójával végeztek. A többszörös összehasonlítások esetében nem történt korrekció a szignifikánsnak elfogadott p-értékben, így az I-es típusú hiba lehetősége miatt az eredmények pusztán leíró jelentőséggel bírnak.

EREDMÉNYEK

Jellemzők bemutatása

Az tanulmányban résztvevő 138 beteg igazolt NCIP-s volt. Átlagéletkoruk 56 év (IQR: 42-68; 22-98 év közöttiek), és 75 férfi beteg (54,3%) volt. Közülük 102-en (73,9%) kerültek elkülönítő kórterembe, 36 (26,1%) esetben intenzív osztályos kezelés volt szükséges valamely szervi elégtelenség miatt (2. táblázat). Az első tünetek megjelenésétől a dyspnoe jelentkezéséig, a kórházi felvételig és ARDS jelentkezéséig eltelt átlagos idő 5 nap (IQR: 1-10 nap), 7 nap (IQR: 4-8) és 8 nap (6-12 nap) volt. A 138 beteg közül 64 (46,6%) rendelkezett legalább 1, egyidejűleg fennálló társbetegséggel. A leggyakoribb társbetegségek a hypertensio (43[31,2%]), a diabetes (14 [10,1%]), valamilyen cardovacularis megbetegedés (20 [14,5%]), és a malignitas (10 [7,2%]) voltak.

A betegség kezdetén leggyakrabban jelentkező tünetek a láz (136 [98,6%]), fáradékonyság (96 [69,6%]), száraz köhögés (82 [59.4%]), myalgia (48 [34,8%]), dyspnoe (43 [31,2%]) voltak. Kevésbé gyakori tünetek közé tartozik a fejfájás, szédülés, hasi fájdalom, hasmenés, hányinger, hányás (2. táblázat). 14 beteg (10,1%) esetében a lázat és dyspnoet 1-2 nappal megelőzték gastrointestinalis tünetek, hasmenés, hányinger.

Azon betegekkel összehasonlítva, akiknek nem volt szükségük intenzív osztályos kezelésre (n=102), az intenzív osztályos kezelésben részesült betegek szignifikánsan idősebbek voltak (átlagéletkor 66 év [IQR: 57-78] vs 51 év [37-62; P<0,001]), és jellemzően valamilyen egyéb betegségben is szenvedtek, úgymint hypertensio (21 [58.3%] vs 22 [21,6%]), diabetes (8 [22,2%] vs 6 [5,9%] ) cardiovascularis eltérés (9 [25%] vs 11 [10,8%]) és cerebrovascularis eltérés (6 [16,7%] vs 1 [1%]).

Az intenzív osztályos kezelést igénylő betegeknél gyakrabban volt megfigyelhető torokfájás, dyspnoe, szédülés, hasi fájdalom és étvágytalanság.

Vitális- és laborparaméterek az intenzív ellátásban részesült (ICU), és nem részesült (Non-ICU) betegek esetében

A két betegcsoportban a szívfrekvencia, légzésszám, és artériás középnyomás tekintetében nem volt különbség. Ezeket az értékeket a kórházi felvétel napján minden betegnél dokumentálták, majd aszerint osztották két csoportra a betegeket, hogy volt-e szükség intenzív osztályos ellátásra.

A laboreredmények tekintetében számos eltérést tapasztaltak az intenzív osztályos kezelést igénylő (ICU) és nem igénylő (non-ICU) betegek között. Ide sorolhatók az emelkedett fehérvérsejt és neutrophyl granulocyta szám, emelkedett D-dimer, creatin-kinase, és creatin érték. Mind a 138 beteg mellkas CT felvételén kétoldali beszűrődés volt látható.

Az első tünetek jelentkezésétől az intenzív osztályos felvételig eltelt idő átlagosan 10 nap volt (IQR: 6-12) (1. táblázat). Az intenzív osztályos felvétel napján a Glasgow kóma skála, SOFA és APACHE II értékek a következőképp alakultak: 15 (IQR: 9-15), 17 (IQR: 10-22), és 5 (IQR: 3-6). Az átlagos parciális oxigénnyomás 68 mm Hg (IQR: 56-89) volt, a FiO2 átlagos parciális nyomása 136 mmHg (IQR: 103-234).

pneumonia - 3. táblázat a betegség súlyossága és vérgáz analízis az ICU-ban
1. táblázat

Szervi elégtelenségek és fő kezelésük

A 138 betegnél jelentkező szervi elégtelenséget és kezelésüket az alábbi táblázat mutatja.

2. táblázat

2020. február 3-án 85 beteg (61,6%) még mindig kórházban feküdt. 47 beteget (34,1%) nyilvánítottak gyógyulttá és 6 (4,3%) halt meg. A 36 ICU beteg közül 11 még mindig az intenzív osztályon volt, 9-et hazabocsátottak, 10-et visszahelyeztek nem-intenzív részlegre, és 6-an vesztették életüket. A 11 intenzív osztályon kezelt beteg közül 6-nak volt szüksége invazív lélegeztetésre, (közülük 1-et részesítettek extracorporalis membran oxygenisatioban), és 5-nek non-invazív lélegeztetésre.

A 138 vizsgált betegnél leggyakrabban fellépő komplikációk a shock (12 [8,7%]), az ARDS (27 [19,6%]), arrhythmia (23 [16,7%]) és az akut szívelégtelenség (10 [7,2%]) voltak. Az intenzív osztályon kezelt betegeknél sokkal nagyobb számban fordult elő a fenti szövődmények valamelyike.

A legtöbb beteg antivirális terápiában részesült (oseltamivir 124 [89,9%]), sokuk antibiotikum terápiát kapott (moxifloxacin, 89 [64,4%], ceftriaxon, 34 [24,6%], azithromycin, 25 [18,1%], és néhányan glükokortikoid kezelésben is részesültek (62 [44,9%]).

Intenzív osztályos kezelés során 4 beteg (11,1%) kapott magas áramlású oxigént, 15 betegnél (44,4%) non-invazív lélegeztetést alkalmaztak. Invazív lélegeztetésre 17 esetben (47,2%) volt szükség, melyből 1 esetben ECMO volt szükséges. 13 estben volt szükség vasopressor adására, 2 esetben pedig művese kezelésre.

NCIP-s betegek laboreredményeinek alakulása

Hogy meghatározzák az NCIP progressziója során jelentkező klinikai jellemzőket, 6 klinikai laboratóriumi paraméter változását vizsgálták, ideértve a vérkép, és vérkémia változásait. Ezeket az eredményeket a tünetek jelentkezésének első napjától a 19. napig monitorozták 2 naponta. Január 28-ig 33 lezárt esetet elemeztek.

A kórházi tartózkodás során a legtöbb betegnél jellemző eltérés volt a lymphopaenia, amelynek mértéke súlyosabb volt azoknál a betegeknél, akik később elhunytak. A betegség azonos szakaszában a fehérvérsejt és neutrophyl granulocyta szám magasabb volt a későbbi halálos áldozatoknál, mint azoknál, akik túlélték a betegséget. A D-dimer érték szintén magasabb volt az elhunytak között. Ehhez hasonlóan a betegség előrehaladtával és a klinikai státusz romlásával a serum urea-nitrogen és a creatinine szint is emelkedett a halál beállta előtt.

A feltételezett kórházi terjedés és fertőzés

A 138 beteg közül 57-en (41,3%) feltehetően a kórházban fertőződtek meg. Ebből 17-en (12,3%) egyéb okból voltak kórházi kezelés alatt, 40-en (29%) pedig kórházi dolgozók voltak. A hospitalizált betegek közül 7-en a sebészeten, 5-en a belgyógyászaton, 5-en pedig onkológiai osztályon feküdtek. A kórházi dolgozók közül 31-en (77,5) belgyógyászati osztályon dolgoztak, 7-en (17,5%) a sürgősségi ellátásban, 2-en (5%) az intenzív osztályon.

A kutatásban részt vevő betegek közül egynél jelentkezett hasi fájdalom, mint első tünet, őt a sebészeti osztályra vették fel. Ezen az osztályon a dolgozók közül feltételezhetően 10-en fertőződtek meg a beteg által. A betegről betegre történő fertőzés szintén feltehető, mivel ugyanebben a kórteremben legalább további 4 beteg fertőződött meg, mindegyiküknél atípusos hasi fájdalom jelentkezett. A 4 betegből 1-nél jelentkezett láz, őt diagnosztizálták n-CoV fertőzéssel, és ezt követően elkülönítették. Később a másik 3 betegnél is jelentkezett láz, és őket is n-CoV fertőzéssel diagnosztizálták.

Összefoglalás

Ez a tanulmány jelen állás szerint a legnagyobb esetszámmal rendelkező tanulmány, amely a NCIP-s eseteket foglalja össze. 2020 február 3-áig a tanulmányban résztvevő 138 beteg 26%-ánál volt szükség intenzív osztályos kezelésre, 34,1%-ot hazabocsátottak, 6-an (4,3%) elhunytak, és a betegek 61,6%-a továbbra is kórházi kezelésre szorult. A gyógyult betegek (n=47) kórházi tartózkodási ideje átlagosan 10 nap (IQR: 7-14 nap) volt. A betegség kezdetétől a dyspnoe-ig eltelt idő 5 nap, a kórházi felvételig eltelt idő 7 nap, az ARDS kialakulásáig eltelt idő pedig 8 nap volt. A betegség bevezető tünetei a láz, száraz köhögés, myalgia, fáradékonyság, dyspnoe és étvágytalanság voltak, habár a betegek jelentős része atípusos tünetekkel jelentkezett, mint hasmenés és hányinger. A fő szövődmények a kórházi kezelés alatt az ARDS, a shock és az arrythmia voltak. Az NCIP típusos mellkas CT lelete a kétoldali foltos árnyékoltság és a tejüveg homály volt. A legtöbb kritikus állapotú beteg idős, komorbid beteg volt.

A legtöbb betegnek szüksége volt oxigénre, kis részük invazív lélegeztetésre vagy ECMO-ra szorult.

Jelen tanulmány valószínűsíti a 2019-nCoV emberek közötti gyors transzmisszióját.

Erre egy előző tanulmány (15) által leírt reprodukciós számból (R0) következtethetünk.

Ahogy a betegség átterjed egy másik emberre, úgy az esetszám megduplázódik.

Az R0 a vírus fertőzőképességét jellemzi. .Az R0 érték azt jelenti, hogy a fertőzésre fogékony populációban egy beteg a fertőzöttségének időtartama alatt átlagosan hány embernek adja tovább a vírust. A becsült R0 érték a 2019-nCoV esetén R0= 2,2 (15). A gyors terjedés egyik oka, hogy a betegség korai szakában a tünetek nem jellegzetesek, és így nehéz a betegek elkülönítése, és szűrése.

Egy tanulmányban (16) azon betegek széklet mintájában, akik hasi fájdalommal jelentkeztek, kimutatható volt a n-CoV. Az ilyen atípusos tünetekkel jelentkező megbetegedések kiszűrése kiemelt nehézséget jelent. A betegség emberről emberre való gyors terjedésében nagy szerepe van a szoros kontaktusnak (10,11,15).

Azon betegek körében, akiknél szükség volt intenzív osztályos kezelésre, nagyobb arányban fordultak elő idős, és komorbid betegek, ami arra utal, hogy a súlyos végkimenetel szempontjából ezek rizikófaktorok lehetnek. Az adatok alapján az intenzív osztályon kezeltek között nem volt erős eltolódás a féri-nő arányban. Egy korábbi tanulmány (8) azt mutatta, hogy férfiak nagyobb eséllyel fertőződtek meg. Ennek a lehetséges magyarázata, hogy a tanulányban vizsgált fertőzöttek a Huanan Nagybani Halpiaccal álltak kapcsolatban, és a fertőzött férfiak nagy része itteni dolgozó volt.

Azoknál a betegeknél, akik az intenzív osztályra kerültek sokkal gyakrabban jelentkezett dyspnoe, étvágytalanság és hasi fájdalom. A bevezető tünetek segíthetnek az orvosoknak elkülöníteni a rosszabb kilátású betegeket.

A vizsgált kohorszban nagyobb volt azon betegek aránya, akik invazív lélegeztetésre szorultak súlyos hypoxia miatt, mint a korábbi vizsgálatokban (9), valószínűleg azért, mert az előző vizsgálatok az NCIP epidémia korai szakaszában készültek, ezek az esetek pedig már a járvány kitörésének idején.

A jelen vizsgálatban leírt legfontosabb labor elváltozások az alacsony lymphocytaszám, a megnyúlt prothrombin idő, és az emelkedett lactat-dehydrogenase szint. Az intenzív osztályon kezelt betegeknél több volt a laboreltérés, mint a nem intenzív osztályon kezelt betegeknél.

Ez arra enged következtetni, hogy a 2019-nCoV fertőzés gyengíti a sejtes immunválaszt, aktiválja a véralvadási rendszert, valamint a myocardium, a máj-, és vese károsodását okozza.

Ezek a laboreltérések hasonlóak a korábbi SARS és MERS fertőzöttek laboreltéréseihez.

A lezárt esetekben a laboratóriumi értékek a következőképp változtak: a fertőzésben elhunytak esetében jellemző volt az emelkedett a D-dimer, a neutrophyl granulocytaszám, a szérum urea-nitrogen, és a kreatinin, míg a lypmocytaszám a halál beálltáig tovább csökkent. A neutrophyliát a vírus által indukált citokin-vihar, a véralvadási rendszer aktiválódását a tartós gyulladásos válaszreakció, az akut veseelégtelenséget pedig maga a vírus, a hypoxia és a shock okozhatja. Ez a három elváltozás okozhatja a NCIP-s betegek halálát.

Mindeddig nincs a vírus ellen hatásos terápia a szupportív terápián kívül (17). Jelenleg az egyetlen megoldás az infekció-kontroll. A védőfelszerelések használata segíthet csökkenteni a fertőzés átvitelét. A korai diagnózis és szupportív kezelés javíthat a betegség kimenetelén. Az antibiotikus terápia hatástalan és mindeddig nem sikerült olyan antivirális terápiát sem találni, amely bizonyítottan hatásos lenne. Minden, a tanulmányban résztvevő beteg kapott valamilyen antibakteriális szert, emellett 90 %-uk antivirális, 45 %-uk methylprednisolone terápiát. Az oseltamivir és a methylprednisolon dózisát a betegség súlyosságának megfelelően állították be, bár a terápiák sikerességét nem tudták igazolni.

Jelen tanulmánynak számos limitációja van. Először is, hogy a NCIP diagnózisa légúti váladékmintákból történt PCR-rel. A betegek szérumát nem használták viraemia kimutatására, annak ellenére, hogy a vírus szérumszintje potenciálisan hasznos marker a betegség súlyosságának megítélésére, és szükséges lenne meghatározni NCIP-ben. Másodszor a kórházi terjedés nem bizonyítható, csak feltehető, mivel lehetséges, hogy a fertőzött betegek már máshol fertőződtek meg. Harmadszor, a cikk írásának időpontjában a vizsgált 138 beteg nagy része még mindig kórházi kezelés alatt áll.

Összességében nehéz megjósolni a súlyos kimenetelű esetek rizikófaktorait, és a betegség lefolyásának további vizsgálata szükséges.

Konklúzió

A tanulmányban vizsgált 138 NCIP-s beteg esetében 41%-nál feltételezhető volt a kórházi megfertőződés, a betegek 24 %-a részesült intenzív osztályos ellátásban, 4,3%-uk elhunyt.

Hivatkozásjegyzék

1. Lu H, Stratton CW, Tang YW. Outbreak of pneumonia of unknown etiology in Wuhan China: the mystery and the miracle [published January 16, 2020]. J Med Virol. 2020. doi:10.1002/jmv.25678 jama.com

2. Hui DS, I Azhar E, Madani TA, et al. The continuing 2019-nCoV epidemic threat of novel coronaviruses to global health: the latest 2019 novel coronavirus outbreak in Wuhan, China [published January 14, 2020]. Int J Infect Dis. 2020; 91:264-266. doi:10.1016/j.ijid.2020.01.009

3. Wuhan Municipal Health Commission. Report of novel coronavirus-infected pneumonia in China. Published January 20, 2020. Accessed January 31, 2020. http://wjw.wuhan.gov.cn/front/web/showDetail/2020012009077

4. Paules CI, Marston HD, Fauci AS. Coronavirus infections—more than just the common cold [published January 23, 2020]. JAMA. doi:10.1001/jama.2020.0757

5. Wuhan Municipal Health Commission. Report of clustering pneumonia of unknown etiology in Wuhan City. Published December 31, 2019. Accessed January 31, 2020. http://wjw.wuhan.gov.cn/front/web/showDetail/2019123108989

6. World Health Organization. Novel coronavirus(2019-nCoV): situation report—15. Accessed February 5, 2020. https://www.who.int/docs/default-source/coronaviruse/situation-reports/20200204-sitrep-15-ncov.pdf

7. Zhu N, Zhang D, Wang W, et al; China Novel Coronavirus Investigating and Research Team. A novel coronavirus from patients with pneumonia in China, 2019 [published January 24, 2020]. N Engl J Med. doi:10.1056/NEJMoa2001017

8. Chen N, Zhou M, Dong X, et al. Epidemiological and clinical characteristics of 99 cases of 2019 novel coronavirus pneumonia in Wuhan, China: a descriptive study [published January 29, 2020]. Lancet. doi:10.1016/S0140-6736(20)30211-7

9. Huang C, Wang Y, Li X, et al. Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China [published January 24, 2020]. Lancet. doi:10.1016/S0140-6736(20)30183-5

10. Chan JF-W, Yuan S, Kok K-H, et al. A familial cluster of pneumonia associated with the 2019 novel coronavirus indicating person-to-person transmission: a study of a family cluster [published January 24, 2020]. Lancet. 2020; S0140-6736(20) 30154-9. doi:10.1016/S0140-6736(20)30154-9

11. Phan LT, Nguyen TV, Luong QC, et al. Importation and human-to-human transmission of a novel coronavirus in Vietnam [published January 28, 2020]. N Engl J Med. doi:10.1056/NEJMc2001272

12. World Health Organization. Clinical management of severe acute respiratory infection when novel coronavirus (nCoV) infection is suspected: interim guidance. Published January 28, 2020. Accessed January 31, 2020. https://www.who.int/publications-detail/clinical-management-of-severe-acute-respiratory-infection-when-novel-coronavirus-(ncov)-infection-is-suspected

13. Ranieri VM, Rubenfeld GD, Thompson BT, et al; ARDS Definition Task Force. Acute respiratory distress syndrome: the Berlin definition. JAMA. 2012;307(23):2526-2533. doi:10.1001/jama.2012.5669

14. Kidney Disease: Improving Global Outcomes (KDIGO) Acute Kidney Injury Work Group. KDIGO Clinical Practice Guideline for Acute Kidney Injury. Kidney Int Suppl. 2012;2:1.

15. Li Q, Guan X, Wu P, et al. early transmission dynamics in Wuhan, China, of novel coronavirus-infected pneumonia. [published on January 29, 2020]. N Engl J Med. 2020. doi:10.1056/NEJMoa2001316

16. Zhang H, Kang ZJ, Gong HY, et al. The digestive system is a potential route of 2019 nCoV infection: a bioinformatics analysis based on single-cell transcriptomes. Preprint. Posted online January 31, 2020. bioRxiv 927806. doi:10.1101/2020.01.30.927806 17. de Wit E, van Doremalen N, Falzarano D, Munster VJ. SARS and MERS: recent insights into emerging coronaviruses. Nat Rev Microbiol. 2016;14 (8):523-534. doi:10.1038/nrmicro.2016.81


További információ a különböző pneumóniás megjelenési formákról itt.